Files in this item

FilesDescriptionFormat

application/pdf

application/pdf8026459.pdf (4MB)Restricted to U of Illinois
(no description provided)PDF

Description

Title:Features of the Initiation of Translation of Two Plant Viral Messenger-Rnas
Author(s):Browning, Karen Shive
Department / Program:Biochemistry
Discipline:Biochemistry
Degree Granting Institution:University of Illinois at Urbana-Champaign
Degree:Ph.D.
Genre:Dissertation
Subject(s):Chemistry, Biochemistry
Abstract:Wheat germ ribosomes combine with the AUG codon at positions 30-32 from the 5'-terminus of in vitro radioiodinated satellite tobacco necrosis virus (STNV) RNA to form initiation complexes that protect specific regions of the RNA from attack by ribonucleases. Wheat germ 80S ribosomes protect a "limit" region 19-52 nucleotides from the 5'-terminus. Wheat germ 40S ribosomes protect a "limit" region 10-47 nucleotides from the 5'-terminus. Characterization of the ribosome protected regions from ribonuclease attack establishes that wheat germ 40S and 80S ribosomes form initiation complexes with a linear conformation of STNV RNA lacking the proposed 5'-terminal loop and stem anticipated by Leung et al. {(1979) Biochemistry 18, 1361-1366}. The 5'-terminus of the small virion mRNA of the cowpea strain of tobacco mosaic virus (C(,c)-TMV) contains a m('7) (5')ppp(5')Gp... cap group. The 5'-terminal sequence of this RNA is m('7) G(5')ppp(5')GUAUUUGAUGAUGGCAUACUCGAUUCCGACUC^C(,C)AG(,C)...(' ). The codons following the consecutive AUGs match the N-terminal amino acid sequence of the coat protein of C(,c)-TMV. Wheat germ 80S ribosomes protect regions adjacent to the two consecutive AUGs from ribonuclease attack. Therefore one or both of the AUG sequences serve as sites for the initiation of translation of the small virion RNA of C(,c)-TMV.
Issue Date:1980
Type:Text
Language:English
Description:116 p.
Thesis (Ph.D.)--University of Illinois at Urbana-Champaign, 1980.
URI:http://hdl.handle.net/2142/67398
Other Identifier(s):(UMI)AAI8026459
Date Available in IDEALS:2014-12-14
Date Deposited:1980


This item appears in the following Collection(s)

Item Statistics