<?xml version="1.0" encoding="UTF-8"?>
<?xml-stylesheet type="text/xsl" href="/oai-pmh.xsl"?>
<OAI-PMH xmlns="http://www.openarchives.org/OAI/2.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.openarchives.org/OAI/2.0/ http://www.openarchives.org/OAI/2.0/OAI-PMH.xsd">
  <responseDate>2026-09-22T14:10:30Z</responseDate>
  <request identifier="oai:www.ideals.illinois.edu:2142/67398" metadataPrefix="etdms" verb="GetRecord">https://www.ideals.illinois.edu/oai-pmh</request>
  <GetRecord>
    <record>
      <header>
        <identifier>oai:www.ideals.illinois.edu:2142/67398</identifier>
        <datestamp>2023-07-11</datestamp>
        <setSpec>col_2142_5131</setSpec>
        <setSpec>col_2142_14795</setSpec>
        <setSpec>com_2142_5130</setSpec>
        <setSpec>com_2142_14794</setSpec>
        <setSpec>com_2142_14793</setSpec>
        <setSpec>com_2142_8903</setSpec>
      </header>
      <metadata>
        <thesis xmlns="http://www.ndltd.org/standards/metadata/etdms/1.1/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:dc="http://purl.org/dc/elements/1.1/" xsi:schemaLocation="http://www.ndltd.org/standards/metadata/etdms/1.1/ http://www.ndltd.org/standards/metadata/etdms/1.1/etdms11.xsd http://purl.org/dc/elements/1.1/ http://www.ndltd.org/standards/metadata/etdms/1.1/etdmsdc.xsd">
          <dc:creator>Browning, Karen Shive</dc:creator>
          <dc:date>2014-12-14T04:27:51Z</dc:date>
          <dc:date>2014-12-14T04:27:51Z</dc:date>
          <dc:date>10000-01-01</dc:date>
          <dc:date>1980</dc:date>
          <dc:date>1980</dc:date>
          <dc:description>Wheat germ ribosomes combine with the AUG codon at positions 30-32 from the 5'-terminus of in vitro radioiodinated satellite tobacco necrosis virus (STNV) RNA to form initiation complexes that protect specific regions of the RNA from attack by ribonucleases. Wheat germ 80S ribosomes protect a &amp;quot;limit&amp;quot; region 19-52 nucleotides from the 5'-terminus. Wheat germ 40S ribosomes protect a &amp;quot;limit&amp;quot; region 10-47 nucleotides from the 5'-terminus. Characterization of the ribosome protected regions from ribonuclease attack establishes that wheat germ 40S and 80S ribosomes form initiation complexes with a linear conformation of STNV RNA lacking the proposed 5'-terminal loop and stem anticipated by Leung et al. {(1979) Biochemistry 18, 1361-1366}. The 5'-terminus of the small virion mRNA of the cowpea strain of tobacco mosaic virus (C(,c)-TMV) contains a m('7) (5')ppp(5')Gp... cap group. The 5'-terminal sequence of this RNA is m('7) G(5')ppp(5')GUAUUUGAUGAUGGCAUACUCGAUUCCGACUC^C(,C)AG(,C)...(' ). The codons following the consecutive AUGs match the N-terminal amino acid sequence of the coat protein of C(,c)-TMV. Wheat germ 80S ribosomes protect regions adjacent to the two consecutive AUGs from ribonuclease attack. Therefore one or both of the AUG sequences serve as sites for the initiation of translation of the small virion RNA of C(,c)-TMV.</dc:description>
          <dc:description>Made available in DSpace on 2014-12-14T04:27:51Z (GMT). No. of bitstreams: 1
8026459.pdf: 3661140 bytes, checksum: 6e626b318e5bf089f0ab2d165aa7f2a4 (MD5)
  Previous issue date: 1980</dc:description>
          <dc:description>Embargo set by: Seth Robbins for item 67576
Lift date: Forever
Reason: Restricted to the U of I community idenfinitely during batch ingest of legacy ETDs</dc:description>
          <dc:description>Restricted to the U of I community idenfinitely during batch ingest of legacy ETDs</dc:description>
          <dc:description>U of I Only</dc:description>
          <dc:description>116 p.</dc:description>
          <dc:description>Thesis (Ph.D.)--University of Illinois at Urbana-Champaign, 1980.</dc:description>
          <dc:identifier>http://hdl.handle.net/2142/67398</dc:identifier>
          <dc:identifier>(UMI)AAI8026459</dc:identifier>
          <dc:language>eng</dc:language>
          <dc:subject>Chemistry, Biochemistry</dc:subject>
          <dc:title>Features of the Initiation of Translation of Two Plant Viral Messenger-Rnas</dc:title>
          <dc:type>text</dc:type>
          <degree>
            <name>Ph.D.</name>
            <department>Biochemistry</department>
            <discipline>Biochemistry</discipline>
            <grantor>University of Illinois at Urbana-Champaign</grantor>
            <level>Dissertation</level>
          </degree>
        </thesis>
      </metadata>
    </record>
  </GetRecord>
</OAI-PMH>
